Yang Zhao

Of all the heavy metals that contaminate tobacco, divalent mercuric ion is one of the most dangerous. Thus, a novel label-free and enzyme-free fluorescent method, based on mercury nanoladders integrated with thiazole orange (TO), was developed for rapid, sensitive, and selective detection of Hg

 in aqueous solutions. In this study, we have determined that, in the presence of mercury ions, the thymine bases in probe 1 (P1) and probe 2 (P2) interact with Hg

-T structure, then long double helices of Hg

 nanoladders will eventually result. Subsequently, the fluorescence of the TO dye was strongly enhanced, due to the binding of TO dye to long dsDNA. The increase in fluorescence intensity was linear with Hg

 concentration in the range of 0.02–5 nM, and the limit of detection for this method was 20 pM. In addition, this method exhibits high selectivity, and experiments with tobacco samples also showed good results. We believe that the proposed system accurately and efficiently detects mercury ions within different substrates.

In recent years, because of the use of non-ferrous metal minerals, coal-fired flue gas, and solid waste incineration, a large quantity of heavy metals and toxic substances has been produced, resulting in an increased risk of excessive mercury in tobacco (1–4). Heavy metal ions in tobacco, especially mercury ions, can pose a serious health threat to smokers (5–7). Thus, it is urgent to develop accurate, sensitive, and very specific analytical methods for the determination of trace mercury ions in tobacco.

Various detection methods have been proposed to monitor trace amounts of mercury ions, including atomic absorption spectroscopy (AAS) (8,9), inductively coupled plasma–optical emission spectroscopy (ICP-OES) (10), and gas chromatography (GC) (11). Although these methods are very sensitive and accurate, they tend to be tedious and time-consuming, and depend on expensive instrumentation and professionally trained operators, thus limiting their application. At the same time, colorimetric sensors (12,13), electrochemical sensors (14,15), and fluorescence sensors (16–18) have also been developed to detect mercury ions. However, the colorimetric methodologies require modifications or additional materials to generate a signal response, and electrochemical methods have inherent disadvantages associated with modification requirements and instability of the electrodes. Therefore, fluorescence methods have been developed for mercury ion detection because of their advantages of stability, simplicity, and speed. For example, Wang and associates (16) reported a fluorescent probe based on branch migration for highly sensitive detection of mercury. Hu and associates (17) developed a DNA@MOF biosensor for successive and specific detection of Hg

. In addition, Huang and colleagues (18) developed a sensitive detection method for mercury ions by exonuclease signal amplification. However, cumbersome fluorophore labeling and enzyme-assisted signal amplification makes the above methods complicated and expensive. Thus, to solve the above problems, we have developed an enzyme-free and label-free fluorescence method, based on mercury nanoladder signal amplification and thiazole orange (TO), to detect Hg

This paper explains a simple and enzyme-free assay we have constructed for mercury ion detection based on mercury nanoladder signal amplification integrated with TO. A mercury nanoladder consists of a long double-stranded structure and relatively short sticky ends that are essentially nicked double helices of alternating copolymers (19). TO is a special asymmetric cyanine dye that has a weak fluorescence signal in aqueous solutions, but that exhibits a considerably increased fluorescence intensity when it interacts with double-stranded DNA (20,21). This occurs because when the dye binds to the nucleic acid through the positive and negative charge electrostatic attraction, the quinoline ring becomes embedded in the small groove of the double-stranded DNA molecule. Dye molecules are more planar, due to their steric hindrance, and thus exhibit increased fluorescence enhancement (22). The system discussed in the present study contains two specially designed oligonucleotide probes, probe 1 (P1) and probe 2 (P2). The interaction between thymine and Hg

-T structures, resulting in the formation of nanoladders in the presence of Hg

. In this state, TO can embed in the mercury nanoladders, producing a strong fluorescence emission. Compared with previous methods, this method has the advantages of a simple design, high sensitivity, and reduced cost, and may contribute to increased application prospects for heavy metal detection.

The thymine-rich probe DNA sequences ([P1:5′-ATGCTTCGTTGTCTGTGCCT TCGTGTTGCA-3′] and [P2:5′-ACGGTT GCTCTTCGTTACGTTGCTTCTGAC-3′]) were obtained from Sangon Biotechnology Co., Ltd., and were dissolved in a Tris-HCl buffer (pH 7.4, 20 mM). All the synthetic DNA sequences are listed in Table I. These samples were stored at 4 oC for immediate use and long-term preservation. All other chemicals were obtained directly from commercial sources and used as received. Hg(NO

 was purchased from Sigma Aldrich, and dissolved in 0.5% HNO

. The thiazole orange (TO) was obtained from Tianjin Seans Biochemical Technology Co., Ltd. All other reagents were analytical grade and used without further purification or modification. Ultrapure water used throughout was produced from a Milli-Q water purifying system.

DNA fluorescence intensity was measured at the excitation spectra of 501 nm, using a spectrofluorophotometer (RF-5301PC, Shimadzu) where the slits were set to 5.0 and 5.0 nm for excitation and emission, respectively. The method was evaluated at a fluorescence intensity of 538 nm, which has been demonstrated to be the maximum emission intensity wavelength. Absorbance spectral measurements were carried out on a UV-2450 spectrophotometer (Shimadzu Co.). Native polyacrylamide gel electrophoresis was performed on a DYY-6C electrophoresis (Liuyi Biological Technology Co.).

Active Polyacrylamide Gel Electrophoresis

In a typical experiment, samples 1,2, and 3 included P1, P2, and P1+P2, respectively. Sample 4 was the mixture of P1, P2, and Hg

. All of the samples were incubated at 37 

C for 30 min. We used 12% PAGE gel in a 1xTBE buffer for analysis of the product, and then gel electrophoresis was run for 70 min at a stable voltage of 100 V. Finally, the gel was stained with Stain-All, and then photographed after decolorization.

The DNA probes (P1 and P2) were diluted with Tris-HCL buffer, to give the stock solutions. Then, a 250 μL reaction sample, containing 50 nM P1, 100 nM P2, 1 μM thiazole orange (TO), and different concentrations of Hg

, was prepared in a Tris-HCl buffer, followed by incubation for 30 min. The fluorescence intensity of TO was measured at 520–600 nm, where the maximum emission peak was 538 nm.

We weighed 0.5 g of a tobacco sample into a PTFE digested flask, and then 3.0 mL of concentrated nitric acid and 5.0 mL of 30% hydrogen peroxide were added. The digestate evaporated to near dryness. The residue was dissolved in 5 mL of 5% nitric acid, then the pH was adjusted to near neutral with NaOH and transferred to a 50 mL volumetric flask.


The principle of the proposed method for rapid, label-free, and enzyme-free Hg

 detection is demonstrated in Figure 1. In this study, the system contains two specially designed oligonucleotide probes: the thymine-rich probe 1 (P1), and the thymine-rich probe 2 (P2), with both including two T-rich domains. The background signal of this system is low in the absence of Hg

, owing to P1 and P2 coexisting stably and remaining single-stranded. When Hg

 was introduced into the system, the interaction between thymine and Hg

-T structures, resulting in mercury nanoladders. This cascade reaction will continue until the supply of the Hg

 ions is exhausted. In this state, TO could be embedded in the mercury nanoladders, producing a very strong fluorescent signal. The UV spectra of TO is shown in Figure 2a, and the excitation and emission spectra of TO are shown in Figure 2b, which are 501 nm and 538 nm, respectively.

To validate the feasibility of the proposed method for detecting Hg2+, the emission spectra obtained by fluorescence detection of samples containing different components were analyzed, as shown in Figure 3. From Figure 3, it was observed that, in the absence of Hg2+, the mixture composed of P1 and P2 produced relatively weak fluorescence emission. In the mixed solution of P1, P2, and Hg2+, the fluorescence intensity of TO increased significantly; this may be due to an increase of the double-chain structure in the solution.

Gel electrophoresis experiments were used to further verify the feasibility of the method and the formation of the mercury nanoladder produced by the addition of the target. As shown in Figure 4, the mercury nanoladders product was obvious in Lane 4, proving the feasibility of the amplification system.

The ratio of probes P1 to P2 that affects the fluorescence intensity of the product was optimized. The concentration ratio of probes P1 and P2 was experimentally measured from 1:1 to 1:3, as shown in Figure 6. It can be seen that a ratio of P1:P2 = 1:2 affords the best signal-to-background difference (F/F

 represent the fluorescence intensity of the solution in the presence and absence of Hg

, respectively, and the fluorescence was strongest at 1:2. Therefore, it was determined that at a 1:2 concentration ratio of the probes P1 and P2, the optimum concentration ratio is obtained.

It is worth noting that using TO as the dye agent plays a very important role in the detection of fluorescent signals, and, therefore, it is necessary to optimize the concentration of TO. As shown in Figure 5b, when the concentration of TO is increased from 0.25 μM to 2 μM, a fluorescence emission was observed for detection at a maximum of 1 μM. Therefore, 1 μM is taken as the optimum concentration of TO.

 can promote DNA hybridization and requires optimization of the Mg

 concentration increases, it is observed that the binding efficiency of P1 and P2 is higher, and F/F

-1 is gradually increased. However, at higher concentrations, the background signal is high and F/F

-1 gradually decreases. Figure 5c shows that the fluorescence intensity ratio F/F

-1 reaches a maximum at 1 mM. Therefore, 1 mM of Mg

 was used as the optimum concentration in the assay.

Temperature is an important factor in the reaction, and the intensity of the fluorescence signal is different at different temperatures. As shown in Figure 6a, the fluorescence signal is highest at 37 

C so the overall system reaction is optimized at this temperature.

Incubation time is another important factor affecting the strength of the fluorescence signal. It can be concluded from Figure 6b that a platform is reached by the intensity of the fluorescence signal after more than 30 min of incubation time. Therefore, 30 min pours can be used as the best time for reaction.

In order to understand the sensitivity of this method, the change in fluorescence intensity of Hg

 concentration. From the Figure 7a, the fluorescence signal can be enhanced with the increase of Hg

 concentration under optimal conditions. As shown in Figure 7b, when the Hg

 concentration was from 0.02 nM to 5 nM, the linear regression equation was ∆F = 12.23C + 4.998, and the correlation coefficient is 

represent the fluorescence intensity difference and the Hg

 concentration, respectively. The detection limit of Hg

 detection limits previously reported for various methods are listed in Table II.

To overcome the interference of other ions with Hg

, it is valuable to measure the selectivity of Hg

 by changing different metal ion targets under the same conditions, such as Ni

, respectively. As shown in Figure 8, 1 μM Hg

 significantly altered the intensity of the fluorescent signal in the selective experiment. By comparison, it is found that the interfering metal ions (including Ni

) had no positive effect on the fluorescent signal. At the same time, when other interfering ions and mercury ions are mixed, the change in fluorescence intensity is not much different from that in the presence of mercury ions alone. This result indicates that the present strategy exhibits excellent selectivity for the detection of Hg

, and is not easily interfered by competing ions, resulting in more accurate results.

The proposed method has been successfully applied to the determination of mercury in tap water and tobacco. The recovery of mercury ion by adding different concentrations of mercury ion in a sample was carried out, and the results are shown in Table III. The data in the Table III reveals that the proposed methodology offers great potential for the specific detection of Hg

We have successfully described a sensitive and selective detection method for mercury ions by using mercury nano-ladder signal amplification. P1 and P2 formed a long double-stranded complex after adding mercury ions, also named mercury nanoladders, that had the ability to combine with TO to produce a strong fluorescence emission. Consequently, this approach possesses a significant advantage of avoiding cumbersome labeling procedures and enzymes. At the same time, the method also exhibits excellent sensitivity and selectivity with a limit of detection of 20 pM. Moreover, the system can be practically applied for the detection of Hg

 in tobacco samples, showing an extensive application prospect. The success of the system suggests that it can be employed as a universal sensor for more substrates.

This work was supported by the Basic Research Foundation of Yunnan Province (Nos. 2016CP021, 2017FD236), the Basic Research Foundation of China Tobacco Yunnan Industrial Co., Ltd. (No. 2019XY01, 2018JC04), the Project Foundation of Yunnan Key Laboratory of Tobacco Chemistry (KCFZ-2017-1096) and the Technology talent and platform program of Yunnan province (No. 2019HB079).

(1) S. Haque, M. Zeyaullah, G. Nabi, and P.S. Srivastava, 

(3) J.Z. Wang, S.Y. Ren, G.F. Zhu, L. Xi, Y.G. Han, Y. Luo, and L.F. Du, 

(4) J.J. Deng, Y. Zhang, J.W. Hu, Y. Yi, X.K. Su, X.F. Huang, and F.X. Qin, 

(5) Y. Xu, X. Niu, H. Zhang, L. Xu, S. Zhao, H. Chen, and X. Chen, 

(7) Y. Liu, O.Q, H. Li, M. Chen. Z. Zhang, and Q. Chen, 

(8) Y. Gao, Z. Shi, Z. Long, P. Wu, C. Zheng and X. Hou, 

(9) M. Ghaedi, M. Reza Fathi, A. Shokrollahi and F. Shajarat, 

(10) N.H. Bings, A. Bogaerts, and J.A.C. Broekaert, 

(13) W. Ren, Y. Zhang, W.T. Huang, N.B. Li, and H.Q. Luo, 

(14) F. Tan, L. Cong, N.M. Saucedo, J. Gao, X. Li, and A. Mulchandanib, 

(15) A. Shirzadmehr, A. Afkhami, and T. Madrakian. 

(16) S. Wang, B. Lin, L. Chen, N. Li, J. Xu, J. Wang, Y. Yang, Y. Qi, Y. She, X. Shen, and X. Xiao. 

(17) P.P. Hu, N. Liu, K.Y. Wu, L.Y. Zhai, B.P. Xie, B. Sun, W.J. Duan, W.H. Zhang, and J.X. Chen, 

(18) H. Huang, S. Shi, X. Zheng, and T. Yao, 

(19) Y. Feng, X. Shao, K. Huang, J. Tian, X. Mei, Y. Luo, and W. Xu, 

(20) I. Timtcheva, V. Maximova, T. Deligeorgiev, D. Zaneva, and I. Ivanov, 

(21) M. Jin, X. Liu, X. Zhang, L. Wang, T. Bing, N. Zhang, Y. Zhang, and D. Shangguan, 

(22) I. Timtcheva, V. Maximova, T. Deligeorgiev, N. Gadjev, R. Sabnis, and I. Ivanov, 

(23) Y. Zhu, Y. Cai, Y. Zhu, L. Zheng, J. Ding, Y. Quan, L. Wang, and B. Qi, 

(24) Y. Lv, L. Yang, X. Mao, M. Lu, J. Zhao, and Y. Yin, 

(25) T. Bao, W. Wen, X. Zhang, Q. Xia, and S. Wang, 

(26) Q. Fang, Q. Liu, X. Song, and J. Kang, 

(27) W. Yun, W. Xiong, H. Wu, M. Fu, Y. Huang, X. Liu, and L. Yang, 

(28) S. Wang, X. Li, J. Xie, B. Jiang, R. Yuan, and Y. Xiang, 

Xiaoxi Si, Juan Li, Yuanxing Duan, Yuting Yang, Yuandong Li, Chunbo Liu, Yang Zhao, Fengmei Zhang, Jianjun Xi, Qinpeng Shen, 

are with the Yunnan Key Laboratory of Tobacco Chemistry, at China Tobacco Yunnan Industrial Co., Ltd., in Kunming, in the People's Republic of China. 

is with the Key Laboratory for Green Organic Synthesis and Application of Hunan Province, at the Key Laboratory of Environmentally Friendly Chemistry and Application of Ministry of Education, at the College of Chemistry of Xiangtan University, in Xiangtan in the People's Republic of China. Direct correspondence to: ashb345@126.com

Articles

An Ultrasensitive Fluorescence Method for Mercury Ion Detection Based on Mercury Nanoladder Signal Amplification and Thiazole Orange 

 in tobacco is important for the health of smokers. Thus, a novel G-triplex-based label- and enzyme-free fluorescent method was developed for detecting Hg

 in tobacco. In this system, the target Hg

 ions associate with the DNA complex that serves as a probe through formation of specific thymine-Hg

-T) base pairing, which results in the release of the P2- containing G-triplexes. Subsequently, fluorescence enhancement is achieved by producing G-triplexes, which bind with thioflavine T (ThT). A detection limit of 0.2 nM was achieved within 40 min. The method has been successfully applied to the detection of mercury in tobacco. At this time, the application for detecting Hg

 in tap and river water samples also indicates that further applications are anticipated.

	In recent years, the development of non-ferrous metal minerals, coal-fired flue gas, and solid waste incineration have increased the production of heavy metals and toxic substances in the environment, resulting in increased risk of excessive levels of mercury in tobacco (1–4). This can impart a sizable health risk to smokers when too much mercury, present as Hg

, is deposited in tobacco (5–7). Therefore, it is important to be able to provide rapid and simple detection of the quantities of Hg

 detection methodologies include the use of atomic fluorescence spectrometry (AFS), atomic absorption spectroscopy (AAS), and inductively coupled plasma–atomic emission spectrometry (ICP-AES), but the instrumentation required for such approaches is expensive, and the process is complicated, which limits the application into a broader range of areas. At the same time, colorimetric sensor technology (8–10), electrochemical sensors (11–14), and fluorescence sensors (15–18) have also been developed for the detection of mercury ions. For example, Zhu and associates developed a strategy to detect Hg

 using a highly sensitive colorimetric sensor based on the aggregation of gold nanoparticles driven by cationic polymers (9). The method has the advantages of high efficiency and speed, but requires additional capital investment and more time. Bao and colleagues developed an electrochemical aptamer sensor for Hg

 detection, which makes use of an exonuclease to achieve cycling and amplification, but the enzyme was found to be difficult to store and was easily inactivated (13). To solve the above problems, a fluorescence method (19–25), which has advantages such as stability, simplicity, and rapid detection, has been successfully used for profiling low levels of Hg

. For example, Wang and colleagues developed a DNA-fueled molecular machine for fluorescent detection of Hg

 (19), Chen and associates reported a gold nanorods-based FRET assay for ultrasensitive detection of Hg

 (24). However, the cumbersome fluorophore labeling contributes to making the experimental process more complicated. Therefore, it was imperative to develop an enzyme-free and label-free fluorescence method for the detection Hg

	In the present study, a simplified approach that makes use of a fluorescence probe based on the G-triplex structure to detect Hg

 with high sensitivity is reported. The P1 chain is composed of a large number of T bases, which are bound by Hg

 to form a stable hairpin structure, ThT. The terminal end of the P2 strand was packed with abundant G sequences, which combine to produce enhanced fluorescence in the presence of ThT. Thus, a label- and enzyme-free strategy was implemented for simple and rapid detection of Hg

, avoiding a cumbersome labeling process and avoiding the use of G-triplex enzymes. Moreover, the method has been successfully applied to the detection of mercury in both tobacco and water samples, which indicates that broader applications of this method are anticipated.

	The polyacrylamide gel electrophoresis (PAGE)-purified P1, d(CATTCAATACTTTGGGTACTTCATCATCACTTCCCATTGTATTGAATTAGATCTTCGTA), and the polyacrylamide gel electrophoresis (PAGE)-purified P2, d(CCACATACATCATATTCTCTCATTCAATACAATGGGTAGGGCGGG), were obtained from Sangon Biotechnology Co., Ltd., the P1 and P2 were designed according to previous literature (19). The documentation pertaining to the indicated amino acid sequences is available on the supplier website. The salts used to prepare the ionic solutions, including KCl and Hg (NO

, and trishydroxymethylaminomethane hydrochloride (Tris-HCl) were purchased from Comio Chemical Reagent Co., Ltd. ThT was supplied by J&K Scientific Co., Ltd.

	DNA fluorescence intensity was measured at the excitation band of 420 nm using a spectrofluorophotometer (RF-5301pc, Shimadzu), in which the slits were set to 5.0 and 5.0 nm for excitation and emission, respectively. The method was evaluated at the fluorescence intensity of 490 nm, which has been demonstrated to be the maximum emission intensity. Absorbance spectral measurements were obtained on a UV-2450 spectrophotometer (Shimadzu Co.).

	P1 and P2 were diluted in Tris-HCl buffer, heated to 95 °C for 5 min. and then cooled slowly to room temperature for 1 h. Then 250 µL  reaction samples containing P1 and P2 with different concentrations of Hg

 were prepared in Tris-HCl buffer followed by incubation at 35 °C for 40 min. The fluorescence intensity of ThT was measured in the spectral region 460–580 nm, where the maximum emission was at 490 nm.

	Initially, 0.2000 g of dried tobacco samples and 5.0 mL of concentrated nitric acid and 1.5 mL of hydrogen peroxide were combined in polytetrafluoroethylene (PTFE) high-pressure digestion tanks, and were digested in a microwave digestion apparatus. A graphite furnace electrothermal acid meter was used to catch acid at 120 °C. After 30 min, the sample was centrifuged (10000 r/min) and filtered through a 0.22 μm microporous membrane to eliminate possible interference factors, and the volume was adjusted to 100 mL with an appropriate amount of distilled water. A volume of 100 μL of the above-mentioned shredded tobacco digestion solution was taken, and mixed with 100 μL of probe solution, 200 μL of Tris-HCl buffer solution (pH 7.0), and to that added an appropriate volume of distilled water to a final volume of 1 mL. After being allowed to stand for 10 min, the sample was transferred to a quartz cuvette and the absorbance spectrum measured.

	Under optimal conditions, it was necessary to filter the river samples to avoid insoluble impurities. In the recovery tests, aliquots of tap and river water samples together with the fluorescent probe with different concentrations (10, 20, 30 nM) of Hg

 were added to the probe solutions and incubated for 40 min. All other reaction conditions were the same as in the above procedures.

	Scheme 1 illustrates the operating principle of the proposed method for rapid label- and enzyme-free Hg

 detection. The P1 chain is composed of a large number of T bases, which are bound by Hg

 to form a stable hairpin structure ThT. The terminal end of the P2 strand was packed with abundant G sequences, which combine to enhance the fluorescence intensity in the presence of ThT. Thus, when there was no target, a weak fluorescence intensity was be observed. However, when the target was added, the fluorescence intensity was enhanced significantly.

 was detected by assessing the changes in fluorescence intensity before and after adding Hg

. As shown in Figure 1, when there was no target, a weak fluorescence intensity was observed. When the target was added, the fluorescence intensity was enhanced significantly. At the same time, to further verify feasibility of the experiment, the absorption spectrum of ThT, in which the maximum absorption peak was 420 nm, was verified as shown in Figure 2. 

Optimization of the Experimental Conditions

	For measurement of the enhanced fluorescence intensity, the reaction temperature was found to be a key factor affecting the fluorescence intensity. As shown in Figure 3a, the fluorescence intensity is strongest at 35 °C. Thus, 35 °C should be used as the optimum reaction temperature for subsequent experiments. At the same time, as seen in Figure 3b, an optimal reaction ratio between P1 and P2 can be considered to be 1:1. In addition, we also tested the effect of K

 concentration and pH and ThT concentration on fluorescence intensity. As shown in Figures 3c, 3d, and 3e, the fluorescence intensity reached a maximum at a K

 concentration of 30 mM, and an optimum at pH = 7, and 2 µM can be considered as the optimum concentration of ThT. At the same time, the reaction (incubation) time was also optimized and extended from 10 min to 60 min, as shown in Figure 3f, where the fluorescence intensity gradually increased up to 40 min. The fluorescence intensity plateaued after 40 min and thus was selected as the optimum time for incubation.

	To understand the sensitivity of this strategy, the change in fluorescence intensity of Hg

 at 420 nm was used to quantitatively detect the Hg

 concentration. From Figure 4, the fluorescence intensity is enhanced with addition of increasing Hg

 concentration was increased incrementally from 1 nM to 100 nM, the intensity increased linearly, with a linear regression equation of Y = 0.573C + 118.937 (

= 0.989), where Y and C represent fluorescence intensity and Hg

 concentration, respectively. The detection limit for Hg

 was calculated to be 0.2 nM (3 δ/k) and the results of from methods previously reported for Hg

 detection were compared, as listed in Table I.

	Selective detection represents a critical performance characteristic to verify this strategy. To selectively distinguish between Hg

), we conducted a series of control experiments and the results are summarized in Figure 5. These represent a good illustration of the selectivity for Hg

 and further demonstrates the feasibility of the present strategy.

	To examine the feasibility of the developed fluorescence probe, we analyzed real samples. Six cigarette shreds on the market were measured by this method. As summarized in Table II, the average content of Hg was found to be 36.41 µg/kg in the tested tobacco, which indicates considerable exposure to the smoker if smoking cigarettes for a long time.

	In addition, two real samples of tap and river water were also analyzed to assess the feasibility of the strategy. Various concentrations of Hg

 (10, 20, and 30 nM) were added to tap and river water, and the results are shown in Table III. Appreciable recovery was detected, indicating that the method based on G-triplex can be successfully applied to real samples.

	A G-triplex-based fluorescence strategy for the detection of Hg

 is reported, that avoids cumbersome labeling procedures and unstable enzymes. At the same time, the probe also demonstrates good sensitivity and selectivity for the detection of Hg

. The limit of detection was found to be 0.2 nM with a wide linear range from 1 nM to 100 nM (

 = 0.989). We believe that this strategy provides support for ion detection based on G-triplex probes.

	This work was supported by the Basic Research Foundation of Yunnan Province (Nos. 2016CP021, 2017FD236), the Project Foundation of Yunnan Key Laboratory of Tobacco Chemistry (KCFZ-2017-1096) and the Basic Research Foundation of China Tobacco Yunnan Industrial Co., Ltd. (No. 2019XY01, 2018JC04).

		S. Haque, M. Zeyaullah, G. Nabi, P.S. Srivastava, and A. Ali, 

		J.Z. Wang, S. Y. Ren, G.F. Zhu, L. Xi, Y.G. Han, Y. Luo, and L.F. Du, 

		J.-j. Deng, Y. Zhang, J.-w. Hu, Y. Yi, X.-k. Su, X.-f. Huang, and F.-x. Qin, 

		Y. Xu, X. Niu, H. Zhang, L. Xu, S. Zhao, H. Chen, and X. Chen, J. Agr. 

		Y. Liu, O. Q, H. Li, M. Chen. Z. Zhang, and Q. Chen, 

		Y. Zhu, Y. Cai, Y. Zhu, L. Zheng, J. Ding, Y. Quan, L. Wang, and B. Qi, 

		W. Ren, Y. Zhang, W. T. Huang, N. B. Li, and H. Q. Luo, 

		Y. Lv, L. Yang, X. Mao, M. Lu, J. Zhao, and Y. Yin, Biosens. 

		F. Tan, L. Cong, N. M. Saucedo, J. Gao, X. Li, and A. Mulchandanib, 

		T. Bao, W. Wen, X. Zhang, Q. Xia, and S. Wang, 

		A. Shirzadmehr, A. Afkhami, and T. Madrakian, 

		W. Yun, W. Xiong, H. Wu, M. Fu, Y. Huang, X. Liu, and L. Yang, 

		M.D.L. Cruz-Guzman, A. Aguilar-Aguilar, L. Hernandezad-Ame, A. Bañuelos-Frias, F.J. Medellín-Rodríguez, and G. Palestino, 

		H. Dai, Y. Shi, Y. Wang, Y. Sun, J. Hua, P. Ni,and Z. Li, 

		S. Wang, X. Li, J. Xie, B. Jiang, R. Yuan, and Y. Xiang, 

		Y. Cai, L. Yan, G. Liu, H. Yuan, and D. Xiao, 

		X. M. Li, R. R. Zhao, Y. L. Wei, D, Yang, Z.J. Zhou, J.F. Zhang, and Y. Zhou, 

		G. K. Wang, Q. L. Mi, L. Y. Zhao, J. J. Hu, L. E. Guo, X. J. Zou, B. L. Xiao, and P. Y. Zhou, 

		G. Chen, Y. Jin, L. Wang, J. Deng, and C. Zhang, 

		P.I. Girginova, A.L. Daniel-da-Silva, C.B. Lopes, P. Figueira, M. Oteroa, V.S. Amaral, E. Pereiraa, and T. Trindadea, 

		T. Yu, T.T. Zhang, W. Zhao, J.J. Xu, and H.Y. Chen, 

A novel method was developed for detecting Hg2+ in tobacco, with potential application to mercury detection in environmental water samples.

Yang Zhao

Articles

An Ultrasensitive Fluorescence Method for Mercury Ion Detection Based on Mercury Nanoladder Signal Amplification and Thiazole Orange

A Label- and Enzyme-Free Fluorescent Method for the Rapid and Simple Detection of Hg2+ in Cigarettes Using G-Triplexes as the Signal Reporter