Junheng You

 in tobacco is important for the health of smokers. Thus, a novel G-triplex-based label- and enzyme-free fluorescent method was developed for detecting Hg

 in tobacco. In this system, the target Hg

 ions associate with the DNA complex that serves as a probe through formation of specific thymine-Hg

-T) base pairing, which results in the release of the P2- containing G-triplexes. Subsequently, fluorescence enhancement is achieved by producing G-triplexes, which bind with thioflavine T (ThT). A detection limit of 0.2 nM was achieved within 40 min. The method has been successfully applied to the detection of mercury in tobacco. At this time, the application for detecting Hg

 in tap and river water samples also indicates that further applications are anticipated.

	In recent years, the development of non-ferrous metal minerals, coal-fired flue gas, and solid waste incineration have increased the production of heavy metals and toxic substances in the environment, resulting in increased risk of excessive levels of mercury in tobacco (1–4). This can impart a sizable health risk to smokers when too much mercury, present as Hg

, is deposited in tobacco (5–7). Therefore, it is important to be able to provide rapid and simple detection of the quantities of Hg

 detection methodologies include the use of atomic fluorescence spectrometry (AFS), atomic absorption spectroscopy (AAS), and inductively coupled plasma–atomic emission spectrometry (ICP-AES), but the instrumentation required for such approaches is expensive, and the process is complicated, which limits the application into a broader range of areas. At the same time, colorimetric sensor technology (8–10), electrochemical sensors (11–14), and fluorescence sensors (15–18) have also been developed for the detection of mercury ions. For example, Zhu and associates developed a strategy to detect Hg

 using a highly sensitive colorimetric sensor based on the aggregation of gold nanoparticles driven by cationic polymers (9). The method has the advantages of high efficiency and speed, but requires additional capital investment and more time. Bao and colleagues developed an electrochemical aptamer sensor for Hg

 detection, which makes use of an exonuclease to achieve cycling and amplification, but the enzyme was found to be difficult to store and was easily inactivated (13). To solve the above problems, a fluorescence method (19–25), which has advantages such as stability, simplicity, and rapid detection, has been successfully used for profiling low levels of Hg

. For example, Wang and colleagues developed a DNA-fueled molecular machine for fluorescent detection of Hg

 (19), Chen and associates reported a gold nanorods-based FRET assay for ultrasensitive detection of Hg

 (24). However, the cumbersome fluorophore labeling contributes to making the experimental process more complicated. Therefore, it was imperative to develop an enzyme-free and label-free fluorescence method for the detection Hg

	In the present study, a simplified approach that makes use of a fluorescence probe based on the G-triplex structure to detect Hg

 with high sensitivity is reported. The P1 chain is composed of a large number of T bases, which are bound by Hg

 to form a stable hairpin structure, ThT. The terminal end of the P2 strand was packed with abundant G sequences, which combine to produce enhanced fluorescence in the presence of ThT. Thus, a label- and enzyme-free strategy was implemented for simple and rapid detection of Hg

, avoiding a cumbersome labeling process and avoiding the use of G-triplex enzymes. Moreover, the method has been successfully applied to the detection of mercury in both tobacco and water samples, which indicates that broader applications of this method are anticipated.

	The polyacrylamide gel electrophoresis (PAGE)-purified P1, d(CATTCAATACTTTGGGTACTTCATCATCACTTCCCATTGTATTGAATTAGATCTTCGTA), and the polyacrylamide gel electrophoresis (PAGE)-purified P2, d(CCACATACATCATATTCTCTCATTCAATACAATGGGTAGGGCGGG), were obtained from Sangon Biotechnology Co., Ltd., the P1 and P2 were designed according to previous literature (19). The documentation pertaining to the indicated amino acid sequences is available on the supplier website. The salts used to prepare the ionic solutions, including KCl and Hg (NO

, and trishydroxymethylaminomethane hydrochloride (Tris-HCl) were purchased from Comio Chemical Reagent Co., Ltd. ThT was supplied by J&K Scientific Co., Ltd.

	DNA fluorescence intensity was measured at the excitation band of 420 nm using a spectrofluorophotometer (RF-5301pc, Shimadzu), in which the slits were set to 5.0 and 5.0 nm for excitation and emission, respectively. The method was evaluated at the fluorescence intensity of 490 nm, which has been demonstrated to be the maximum emission intensity. Absorbance spectral measurements were obtained on a UV-2450 spectrophotometer (Shimadzu Co.).

	P1 and P2 were diluted in Tris-HCl buffer, heated to 95 °C for 5 min. and then cooled slowly to room temperature for 1 h. Then 250 µL  reaction samples containing P1 and P2 with different concentrations of Hg

 were prepared in Tris-HCl buffer followed by incubation at 35 °C for 40 min. The fluorescence intensity of ThT was measured in the spectral region 460–580 nm, where the maximum emission was at 490 nm.

	Initially, 0.2000 g of dried tobacco samples and 5.0 mL of concentrated nitric acid and 1.5 mL of hydrogen peroxide were combined in polytetrafluoroethylene (PTFE) high-pressure digestion tanks, and were digested in a microwave digestion apparatus. A graphite furnace electrothermal acid meter was used to catch acid at 120 °C. After 30 min, the sample was centrifuged (10000 r/min) and filtered through a 0.22 μm microporous membrane to eliminate possible interference factors, and the volume was adjusted to 100 mL with an appropriate amount of distilled water. A volume of 100 μL of the above-mentioned shredded tobacco digestion solution was taken, and mixed with 100 μL of probe solution, 200 μL of Tris-HCl buffer solution (pH 7.0), and to that added an appropriate volume of distilled water to a final volume of 1 mL. After being allowed to stand for 10 min, the sample was transferred to a quartz cuvette and the absorbance spectrum measured.

	Under optimal conditions, it was necessary to filter the river samples to avoid insoluble impurities. In the recovery tests, aliquots of tap and river water samples together with the fluorescent probe with different concentrations (10, 20, 30 nM) of Hg

 were added to the probe solutions and incubated for 40 min. All other reaction conditions were the same as in the above procedures.

	Scheme 1 illustrates the operating principle of the proposed method for rapid label- and enzyme-free Hg

 detection. The P1 chain is composed of a large number of T bases, which are bound by Hg

 to form a stable hairpin structure ThT. The terminal end of the P2 strand was packed with abundant G sequences, which combine to enhance the fluorescence intensity in the presence of ThT. Thus, when there was no target, a weak fluorescence intensity was be observed. However, when the target was added, the fluorescence intensity was enhanced significantly.

 was detected by assessing the changes in fluorescence intensity before and after adding Hg

. As shown in Figure 1, when there was no target, a weak fluorescence intensity was observed. When the target was added, the fluorescence intensity was enhanced significantly. At the same time, to further verify feasibility of the experiment, the absorption spectrum of ThT, in which the maximum absorption peak was 420 nm, was verified as shown in Figure 2. 

Optimization of the Experimental Conditions

	For measurement of the enhanced fluorescence intensity, the reaction temperature was found to be a key factor affecting the fluorescence intensity. As shown in Figure 3a, the fluorescence intensity is strongest at 35 °C. Thus, 35 °C should be used as the optimum reaction temperature for subsequent experiments. At the same time, as seen in Figure 3b, an optimal reaction ratio between P1 and P2 can be considered to be 1:1. In addition, we also tested the effect of K

 concentration and pH and ThT concentration on fluorescence intensity. As shown in Figures 3c, 3d, and 3e, the fluorescence intensity reached a maximum at a K

 concentration of 30 mM, and an optimum at pH = 7, and 2 µM can be considered as the optimum concentration of ThT. At the same time, the reaction (incubation) time was also optimized and extended from 10 min to 60 min, as shown in Figure 3f, where the fluorescence intensity gradually increased up to 40 min. The fluorescence intensity plateaued after 40 min and thus was selected as the optimum time for incubation.

	To understand the sensitivity of this strategy, the change in fluorescence intensity of Hg

 at 420 nm was used to quantitatively detect the Hg

 concentration. From Figure 4, the fluorescence intensity is enhanced with addition of increasing Hg

 concentration was increased incrementally from 1 nM to 100 nM, the intensity increased linearly, with a linear regression equation of Y = 0.573C + 118.937 (

= 0.989), where Y and C represent fluorescence intensity and Hg

 concentration, respectively. The detection limit for Hg

 was calculated to be 0.2 nM (3 δ/k) and the results of from methods previously reported for Hg

 detection were compared, as listed in Table I.

	Selective detection represents a critical performance characteristic to verify this strategy. To selectively distinguish between Hg

), we conducted a series of control experiments and the results are summarized in Figure 5. These represent a good illustration of the selectivity for Hg

 and further demonstrates the feasibility of the present strategy.

	To examine the feasibility of the developed fluorescence probe, we analyzed real samples. Six cigarette shreds on the market were measured by this method. As summarized in Table II, the average content of Hg was found to be 36.41 µg/kg in the tested tobacco, which indicates considerable exposure to the smoker if smoking cigarettes for a long time.

	In addition, two real samples of tap and river water were also analyzed to assess the feasibility of the strategy. Various concentrations of Hg

 (10, 20, and 30 nM) were added to tap and river water, and the results are shown in Table III. Appreciable recovery was detected, indicating that the method based on G-triplex can be successfully applied to real samples.

	A G-triplex-based fluorescence strategy for the detection of Hg

 is reported, that avoids cumbersome labeling procedures and unstable enzymes. At the same time, the probe also demonstrates good sensitivity and selectivity for the detection of Hg

. The limit of detection was found to be 0.2 nM with a wide linear range from 1 nM to 100 nM (

 = 0.989). We believe that this strategy provides support for ion detection based on G-triplex probes.

	This work was supported by the Basic Research Foundation of Yunnan Province (Nos. 2016CP021, 2017FD236), the Project Foundation of Yunnan Key Laboratory of Tobacco Chemistry (KCFZ-2017-1096) and the Basic Research Foundation of China Tobacco Yunnan Industrial Co., Ltd. (No. 2019XY01, 2018JC04).

		S. Haque, M. Zeyaullah, G. Nabi, P.S. Srivastava, and A. Ali, 

		J.Z. Wang, S. Y. Ren, G.F. Zhu, L. Xi, Y.G. Han, Y. Luo, and L.F. Du, 

		J.-j. Deng, Y. Zhang, J.-w. Hu, Y. Yi, X.-k. Su, X.-f. Huang, and F.-x. Qin, 

		Y. Xu, X. Niu, H. Zhang, L. Xu, S. Zhao, H. Chen, and X. Chen, J. Agr. 

		Y. Liu, O. Q, H. Li, M. Chen. Z. Zhang, and Q. Chen, 

		Y. Zhu, Y. Cai, Y. Zhu, L. Zheng, J. Ding, Y. Quan, L. Wang, and B. Qi, 

		W. Ren, Y. Zhang, W. T. Huang, N. B. Li, and H. Q. Luo, 

		Y. Lv, L. Yang, X. Mao, M. Lu, J. Zhao, and Y. Yin, Biosens. 

		F. Tan, L. Cong, N. M. Saucedo, J. Gao, X. Li, and A. Mulchandanib, 

		T. Bao, W. Wen, X. Zhang, Q. Xia, and S. Wang, 

		A. Shirzadmehr, A. Afkhami, and T. Madrakian, 

		W. Yun, W. Xiong, H. Wu, M. Fu, Y. Huang, X. Liu, and L. Yang, 

		M.D.L. Cruz-Guzman, A. Aguilar-Aguilar, L. Hernandezad-Ame, A. Bañuelos-Frias, F.J. Medellín-Rodríguez, and G. Palestino, 

		H. Dai, Y. Shi, Y. Wang, Y. Sun, J. Hua, P. Ni,and Z. Li, 

		S. Wang, X. Li, J. Xie, B. Jiang, R. Yuan, and Y. Xiang, 

		Y. Cai, L. Yan, G. Liu, H. Yuan, and D. Xiao, 

		X. M. Li, R. R. Zhao, Y. L. Wei, D, Yang, Z.J. Zhou, J.F. Zhang, and Y. Zhou, 

		G. K. Wang, Q. L. Mi, L. Y. Zhao, J. J. Hu, L. E. Guo, X. J. Zou, B. L. Xiao, and P. Y. Zhou, 

		G. Chen, Y. Jin, L. Wang, J. Deng, and C. Zhang, 

		P.I. Girginova, A.L. Daniel-da-Silva, C.B. Lopes, P. Figueira, M. Oteroa, V.S. Amaral, E. Pereiraa, and T. Trindadea, 

		T. Yu, T.T. Zhang, W. Zhao, J.J. Xu, and H.Y. Chen, 

Articles

A novel method was developed for detecting Hg2+ in tobacco, with potential application to mercury detection in environmental water samples.

Junheng You

Articles

A Label- and Enzyme-Free Fluorescent Method for the Rapid and Simple Detection of Hg2+ in Cigarettes Using G-Triplexes as the Signal Reporter